explanation: to improve the patient's condition a clot buster is required streptokinase (produced from streptococcus bacteria) another is to lower the cholesterol levels statins (produced from yeast Monascus purpureus) can be used.
explanation: it is morphine, Physically it appears as a white, odourless, crystalline compound
4. Water samples were collected at points A, B and C in a segment of a river near a sugar factory and tested for BOD level. The BOD levels of samples A, B and C were 400 mg/L, 480 mg/L and 8 mg/L respectively. What is this indicative of? Explain why the BOD level gets reduced considerably at the collection point C?
explanation: At collection points A and B, the BOD level is high due to high organic pollution caused by sugar factories and sewage discharge. At collection point C, the water was released after secondary treatment/ biological treatment (where vigorous growth of useful aerobic microbes into flocs consume the major part of the organic matter present in the river water or effluent due to sugar factory and sewage discharge)
5 An ecologist study an area with population A, thriving on unlimited resources and showing exponential growth, and introduced populations B and C to the same area. What will be the effect on the growth pattern of the populations A, B and C when living together in the same habitat?
explanation: This interaction will lead to competition between the individuals of populations A, B and C for resources. Eventually, the ‘fittest’ individuals will survive and reproduce. The resources for growth will become finite and limiting, and population growth will become realistic.
6 With the decline in the population of fig species it was noticed that the population of wasp species also started to decline. What is the relationship between the two and what could be the possible reason for decline of wasps?
OR
With the increase in the global temperature, the inhabitants of Antarctica are facing fluctuations in the temperature. Out of the regulators and the conformers, which of the two will have better chances of survival? Give two adaptations that support them to survive in the ambient environment? Give one suitable example.
explanation: The relationship between the plant and pollinator is called mutualism. Fig depends on a wasp for pollination, and wasp depends on fig for food and shelter With the decline in the population of figs, wasp loses their source of food and shelter.
OR
Regulators; Thermoregulation, Osmoregulation Birds/Mammals
7 How do normal cells get transformed into cancerous neoplastic cells? Elaborate giving three examples of the inducing agents.
OR
A person is suffering from a high-grade fever. Which symptoms will help to identify if he/she is suffering from Typhoid, Pneumonia or Malaria?
explanation: Transformation of normal cells into cancerous neoplastic cells may be induced by following physical, chemical or biological agents causing DNA damage:
● Ionising radiations like X-rays and gamma rays
● Non-ionizing radiations like UV.
● Chemical carcinogens present in tobacco smoke
● Cellular oncogenes (c-onc) or proto-oncogenes, when activated under certain conditions cause cancer. Viruses with oncogenes can transform normal cells to cancerous cells.
OR
If the person has sustained high fever (39° to 40°C), weakness, stomach pain, constipation, headache and loss of appetite, it is Typhoid. If the person has fever, chills, cough and headache; and the lips and fingernails turn gray to bluish, it is Pneumonia. If the person has chills and high fever recurring every three to four days then, it is Malaria.
8 Recognition of an antigenic protein of a pathogen or exposure to a pathogen occurs during many types of immune responses, including active immunity and induced active immunity. Specify the types of responses elicited when human beings get encountered by a pathogen.
explanation: ● When our body encounters an antigenic protein or a pathogen for the first time it produces a response which is of low intensity and our body retains memory of the first encounter.
● The subsequent encounter with the same pathogen elicits a highly intensified response carried out with the help of two special types of lymphocytes present in our blood, B- lymphocytes, and T-lymphocytes.
● The B-lymphocytes produce an army of proteins in response to these pathogens into our blood to fight with them. These proteins are called antibodies. The T-cells themselves do not secrete antibodies but help B-cells produce them.
9 In a pathological lab, a series of steps were undertaken for finding the gene of interest. Describe the steps, or make a flow chart showing the process of amplification of this gene of interest.
explanation: The flow chart shows the three steps involved in the process of PCR showing the following - Denaturation The DNA strands are treated with a temperature of 94Cº (Heat) and the strands are separated. - Annealing The primers anneal to the complementary strands - Extension The DNA polymerase facilitates the extension of the strands.
10 a. ‘The Evil Quartet’ describes the rates of species extinction due to human activities. Explain how the population of organisms is affected by the fragmentation of the habitats.
b. Introduction of alien species has led to environmental damage and the decline of indigenous species. Give any one example of how it has affected the indigenous species?
c. Could the extinction of Steller’s sea cow and passenger pigeon be saved by a man? Give reasons to support your answer.
explanation: a. When a large habitat is broken into small fragments due to various activities, mammals and birds requiring large territories and certain animals with migratory habitats are badly affected, leading to population decline.
b. ● Nile perch introduced in Lake Victoria eventually led to the extinction of an ecologically unique assemblage of more than 200 species of child fish.
● Parthenium/Lantana/water hyacinth caused environmental damage and threat to our native species
● African catfish-Clarias gariepinus introduced for aquaculture purposes is posing a threat to the indigenous catfishes in our rivers.
c. Yes; Humans have overexploited natural resources for their ‘greed’ rather than ‘need’ leading to the extinction of these animals. Sustainable harvesting could have prevented the extinction of these species.
11 a. The image shown below is of a sacred grove found in India. Explain how has human involvement helped in the preservation of these biodiversity rich regions.
b. Value of Z (regression coefficient) is considered for measuring the species richness of an area. If the value of Z is 0.7 for area A, and 0.15 for area B, which area has higher species richness and a steeper
slope?
explanation: a. India’s history of religious and cultural traditions emphasized the protection of nature. In many cultures, tracts of forest are set aside, and all the trees and wildlife within are venerated and given total protection. Sacred groves in many states are the last refuge for a large number of rare and threatened plants.
b. Area A will have more species richness and a steeper slope.
12 The image below depicts the result of gel electrophoresis
If the ladder represents sequence length upto 3000 base pairs (bp),
a. Which of the bands (I - IV) correspond to 2500 bp and 100 bp respectively?
b. Explain the basis of this kind of separation and also mention the significance of this process.
explanation: a. Band III corresponds to 2500 base pairs, and Band IV corresponds to 100bp.
b. The fragments will resolve according to their size. The shorter sequence fragments would move farthest from well as seen in Band IV (100 bp) which is lighter as compared to Band III which is heavier being 2500 base pairs. The significance of electrophoresis is to purify the DNA fragments for use in constructing recombinant DNA by joining them with cloning vectors.
13 Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1 is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.
a. What is the objective of this action?
b. Explain how the gene of interest is introduced into a vector.
c. You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’
3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
d. A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids?
Give a possible way by which you could differentiate non-recombinant from recombinant plasmids.
OR
GM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an experimental study was conducted in 4 different farmlands growing Bt and non Bt-Cotton crops. The farmlands had the same dimensions, and fertility and were under similar climatic conditions. The histogram below shows the usage of pesticides on Bt crops and non-Bt crops in these farm lands.
a. Which of the above 4 farmlands has successfully applied the concepts of Biotechnology to show better management practices and the use of agrochemicals? If you had to cultivate, which crop would you prefer (Bt or Non-Bt) and why?
b. Cotton Bollworms were introduced in another experimental study on the above farmlands wherein no pesticide was used. Explain what effect would a Bt and Non-Bt crop has on the pest.
explanation: a. The two different DNA molecules will have compatible ends to recombine.
b. Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into the DNA of the vector.
c. 2 fragments 5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAG 5’.3’GCATTACAGGA 5’
d. BamH1 site will affect the tetracycline antibiotic resistance gene, hence the recombinant plasmids will lose tetracycline resistance due to the inactivation of the resistance gene. Recombinants can be selected from non-recombinants by plating into a medium containing tetracycline, as the recombinants will not grow in the medium because the tetracycline resistance gene is cut.
a. Farm Land II. Bt crop. Because the use of pesticides is highly reduced for Bt crops// Decrease in pesticide use is also more significant for Bt crops.
b. In Bt cotton a cry gene has been introduced from the bacterium Bacillus thuringiensis (Bt) which causes the synthesis of a toxic protein. This protein becomes active in the alkaline gut of bollworm feeding on cotton, punching holes in the lining and causing the death of the insect. However; a Non-Bt crop will have no effect on the cotton bollworm/ the yield of cotton will decrease / non-Bt will succumb to pest attack.
Comments
Post a Comment