Featured post

ANATOMY OF FLOWERING PLANTS

Image
  What is Plant Anatomy? Plant anatomy is the study of internal structure and organization of tissues in plants. It helps in understanding: Functional adaptation Transport system Growth patterns Tissue Organization in Flowering Plants Flowering plants have three major tissue systems :  Epidermal Tissue System Components: Epidermis Single layer of compact cells No intercellular spaces Covered by cuticle (except roots) Cuticle Made of cutin Prevents water loss Stomata Present mainly on leaves Composed of guard cells Regulate: Gas exchange Transpiration Root hairs Extensions of epidermal cells Increase surface area for absorption Trichomes (in stem) Hair-like structures Protection + reduce transpiration  Functions: Protection Water conservation Gas exchange 🌿 B. Ground Tissue System  Types of Ground Tissue: 1. Parenchyma Living cells, thin cell wall Large vacuole Functions: Storage Photosynthesis ( chlorenchyma ) Air storage ( aerenchyma ) 2. Collenchyma Living cell...

biotechnology class 12 2023

1.Male sterility is widely used in crops such as maize, sunflower for hybrid production. Male sterile plants are created by introducing a gene encoding-

(a) Barnase protein

(b) TA29

(c) Barstar protein

(d) Coat protein

EXPLANATION: (a) Barnase gene was first introduced to produce male sterility in 1990. it is effective fertility restoration system in barstar. it is genetic and heritable.

2. Bodybuilders prefer to drink buffalo milk to build muscle mass. Determine the reason for this?

(a) Easier to digest

(b) Lower fat content

(c) Higher calcium and phosphorus content

(d) Balanced calorie source

EXPLANATION: (c) buffalo milk has high-fat content, higher calcium and phosphorus content

3. An industrially important secondary metabolite which is used as a red pigment in lipsticks and dye for silk is obtained from-

(a) Datura stramonium

(b) Lithospermum erythrorhizon

(c) Digitalis lanata

(d) Coptis japonica

EXPLANATION: (b) Lithospermum erythrorhizon commonly known as purple groomwell, red gromwell commonly grown in China is use to dye for staining fibres and also as food colourant 

4. Proteome of a given cell is dynamic because : 

(a) In response to Internal and external changes the biochemical machinery of the 

cell could be changed.

(b) In response to Internal and external changes the biochemical machinery of the 

cell could not be changed. 

(c) No direct relationship exists between Internal and external changes in the 

biochemical machinery of the cell.

(d) Indirect relationship exists between Internal and external in changes the 

biochemical machinery of the cell.

EXPLANATION:(a) proteome is the entire complement of protein that is or can be expressed by cell, tissue or organism. it is dynamic because in response to internal and external changes the biochemical machinery of cell could be changed.

5. Artificial seeds are produced by-

(a) Encapsulating somatic embryos in calcium alginate beads

(b) Desiccating the somatic embryos with or without coating

(c) Hydrating the somatic embryos 

(d) Hydrating the zygotic embryos.

EXPLANATION:(a) artificial seeds are encapsulated somatic embryos or other vegetative parts which can be sown as seeds and converted into plants.

6. Being a researcher, you want to improve the deficiency of certain amino acids in cereals and legumes. Choose the technique out of the following which will be the best to achieve your goal: 

(a) Plant tissue culture

(b) Adding fertilizers to the soil

(c) Protein engineering 

(d) Vegetative Propagation

EXPLANATION: (c) Protein engineering is the process of developing useful or valuable proteins. It is a young discipline, with much research taking place into the understanding of protein folding and recognition for protein design principles. It has been used to improve the function of many enzymes for industrial catalysis. 

7. Foreign DNA is directly introduced into the recipient cell using a fine micro-syringe to transform it. The probable advantage this provides could be:

a) No specialised equipment required

b) No damage to cells 

c) Low transduction rate 

d) Precision of delivery 

EXPLANATION: (d) precision of delivery

8. A piece of young hypocotyl was cultured in an MS medium in a plant tissue culture lab. 

This is a type of-

(a) Organ culture

(b) Callus culture

(c) Explant culture

(d) Mass cell culture

EXPLANATION: (c) Explant culture

9. Molecular Biologists prefer to use artificial vectors with MCS. List a benefit for this choice. 

(a) Flexibility in choice of insert size

(b) Flexibility in choice of vector size 

(c) Flexibility in choice of host organism

(d) Flexibility in choice of restriction enzyme

EXPLANATION: (d) Flexibility in choice of restriction enzyme

10. Native enzyme Subtilisin is inactivated by bleach, in detergents because of oxidation of methionine at position 222. Choose a strategy that will help overcome this problem: 

(a) Use Pepsin instead of Subtilisin 

(b) Eliminate use of bleach 

(c) Substitute another amino acid at position 222

(d) Use Amylase instead of Subtilisin

EXPLANATION: (c) substitute another amino acid at position 222

11. Culture based approaches for detecting pathogens, as compared to PCR based assays are

(a) Faster, safer but less specific 

(b) Slower but safer and more specific 

(c) Slower, less safe and less specific

(d) Slower, less safe but more specific

Explanation: (c) Slower, less safer and less specific 

12. A 100 Kb DNA fragment has to be cloned in a host cell. Which vector should be used for this experiment?

a) Plasmid

b) Cosmid

c) BAC

d) Bacteriophage lambda

EXPLANATION:(c) BAC

Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R).

Answer these questions selecting the appropriate option given below: 

A. Both Assertion and Reason are true and the reason is the correct explanation of the 

assertion 

B. Both Assertion and Reason are true but the reason is not the correct explanation of 

the assertion 

C. Assertion is true but Reason is false 

D. Both Assertion and Reason are false

13 Assertion-The functional property of whey protein exploited in confectionery is 

browning.

Reason-Whey proteins undergo maillard reaction providing colour and aroma to food 

items

EXPLANATION: A) Both Assertion and Reason are true and the reason is the correct explanation of the 

assertion

14 Assertion- Foaming is a problem in most microbiological processes.

Reason- It is caused due to the presence of fatty acids and silicones in the culture 

medium.

EXPLANATION: (C) Assertion is true but Reason is false

15 Assertion- Whey mixed with herbs and honey is administered to the sick to treat 

ailments like jaundice and infected skin lesions.

Reason - Whey proteins elevates the levels of glutathione which protects the cells from 

harmful oxygen intermediates.

EXPLANATION: (A) Both Assertion and reason are true and reason is the correct answer for the assertion. 

16 Assertion-It‟s difficult to count genes even if we know where the genes are in a given 

genome 

Reason- There is no simple correlation between the intuitive complexity of an 

organism and the number of genes in its genome.

EXPLANATION: A) Both Assertion and Reason are true but the reason is not the correct explanation of the assertion
SECTION B

17 Depict the production and mode of action of tissue plasminogen activator through 
diagram or flowchart.
EXPLANATION: Tissue Plasminogen Activator (tPA)




18 X is a valuable tool in plant breeding, wherein variation in tissue culture regenerated plants from somatic cells can be used for the development of crops with novel traits. Identify „X‟. State any one example where this tool can be used for crop improvement.

OR
Leaf explants of brinjal are showing multiple shoot regeneration in a plant tissue culture laboratory. Which plant regeneration pathway is depicted here? In this process, what would happen if either auxins or cytokinins are high in the medium?

EXPLANATION: Somaclonal variations It helps in the production of mutants e.g. disease resistance in Potato 
OR
Organogenesis If auxins are high in the medium, it promotes rooting while if cytokinins are high, shoot 
formation is promoted.

19 Given below is a list of the first 06 residues of the beta helix in myogloblin from 
different organisms. Based on this information, which amino acids (a) are most 
conserved, and (b) are highly variable.

EXPLANATION: G amino acid is the most conserved, A amino acid is the most variable

20 A doctor has to prescribe a protein rich diet to sportsmen to improve their performance. What are the two parameters that the doctor should consider while prescribing these protein sources. Explain
EXPLANATION: Essential amino acids and BCAA profile: Essential amino acids are those amino acids which have to be obtained from food and cannot be made in our cells.The branched chain amino acids (BCAA) are essential for the biosynthesis of muscle proteins. They help in increasing the bio-availability of high complex carbohydrates intake and are absorbed by muscle cells for anabolic muscle building activity. 
Biological value (BV) measures the amount of protein nitrogen that is retained by the body from a given amount of protein nitrogen that has been consumed. It has been observed that the BV of whey proteins is the highest compared to rice, wheat, soya and egg proteins.

21
(a) Identify the technique shown above.
(b) State any three applications of the technique.
EXPLANATION:a) Production of MoAb
b) This technology has revolutionized the area of diagnostics and antibody-based 
therapies. 
1) The availability of monoclonal antibodies has helped in the early detection of many 
infectious diseases like hepatitis and AIDS. 
2) Therapeutic mAb –
OKT3 Therapeutic mAb - Herceptin OKT-3 is monab-CD3, an immunosuppressant drug given intravenously to reverse the acute rejection of transplanted organs such as the heart, kidney and liver.
Herceptin (trastuzumab) is a monoclonal antibody approved for therapy of early-stage breast cancer that is Human Epidermal growth factor Receptor 2-positive (HER2+).

SECTION C
22 (a) Chymotrypsinogen is inactive form of enzyme chymotrypsin. Which molecular alteration converts it into active form? 
(b)The catalytic triad in chymotrypsin leads to a charge relay system. Justify
OR
Haemoglobin protein of a normal individual has to be compared with that of a person with sickle cell anaemia in a pathology laboratory. Represent the steps of the technique, which can be used for the same, in the form of a flow chart.
EXPLANATION: (a) In chymotrypsinogen, the substrate binding site is blocked and hence the enzyme 
is inactive. In-situ activation of trypsin involves a proteolytic cut in chymotrypsinogen which results in a conformational change, exposing the substrate binding pocket.
(b) Asp 102, His 57 and Ser 195 lie in this order forming a charge relay; The negatively charged aspartate carboxylate residue pulls the Ser –OH proton through His, leaving it with a negative charge Ser195 becomes acidic due to the unique constellation of the three amino acid residues because the protein has folded uniquely in space
OR



23 Given below are few transgenic crops approved by US Food and Drug Administration 
along with the improved character. Name the genes A to F introduced for the 
improved character. 

EXPLANATION:

24 In animal cell culture, the osmolarity of the culture medium has a significant role in cell growth and function. Justify. Which ingredients decide the osmolarity of the medium 
EXPLANATION: Membrane integrity maintained Helps to maintain the shape and size of cells. Salt, glucose and amino acids (any two) are the major ingredients that determine the osmolality of the medium.

25 You have the gene sequence of a protein which has proteolytic activity. How will you establish through tools of bioinformatics that this protein:
(a) Has homologues in other organisms 
(b) Belongs to the chymotrypsin family 
(c) Has a database that can we used to trace the evolutionary history of this proteolytic protein 
EXPLANATION: (a) →BLAST search→ Find out→ homologous sequences in other organisms by looking for gene sequence of given proteolytic enzyme.
(b) Look for conserved domain and find whether belongs to domain of Chymotrypsin or to other family of proteins
(c) ALI database can be used for Phylogenetic (Evolutionary) analysis and alignment of proteins

26 What are type II restriction endonucleases (RE)? Give an example of a type II RE 
that generates flush ends and the sequence recognized by it. Mention two other 
enzymes and their utility in cloning experiment.
EXPLANATION: R.E. type II recognizes a specific DNA sequence and cut within the sequence generating sticky/flush ends. In recombinant DNA technology, we use type II RE as they are highly specific in their action.
Alu I with the restriction site (One strand) 5‟ AGCT‟3 and Sma 1 with the restriction site 5 „CCC GGG‟ 3 (flush ends) (One strand) 
The functions of a) Alkaline phosphatase b) DNA ligase.
  •  The role of alkaline phosphatase is to prevent self-re-ligation of the vector 
  • The role of DNA ligase is to make a 3‟-5‟ phosphodiester bond.

27 Bioinformatics databases provide resources for gene level sequences such as RefSeq, Homologene , Paralogs and UniGene and BLAST . Which of these would you use as most suitable starting point for :
i) Avoiding redundancy in EST data.
ii) For inferring relations among organisms.
iii) Information retrieved from this resource will be used in designing gene chips.
EXPLANATION:: i) UniGene database 
ii) Homologene database
iii. RefSeq database 

28 a) Identify the vector shown below :


b) How can we use LEU2 gene as a selectable marker?
EXPLANATION:  a) p BR 322 1
b) LEU2 gene codes for an enzyme required for the synthesis of amino acid leucine. Yeast cells having this plasmid can grow on a medium lacking leucine and hence can be selected e.g. Yep
SECTION D
29 Mass Spectrometry
Mass spectrometry (MS) has emerged as an important tool in biotechnology. It is extremely useful in obtaining protein structural information such as peptide mass or amino acid sequences. The molecular ions are generated either by a loss or gain of a charge (e.g. electron ejection, protonation or deprotonation). After the ions are formed, they can be separated according to their m/z ratio and finally detected. A protein with a molecular weight of 10,000 daltons generates five different peaks with the ions containing 5, 4, 3, 2, and 1 charge, respectively, as shown below. 
(a)What happens if there is a loss of charge from a biomolecule?
(b)Mass spectrometry is an analytical tool. Justify the statement.
(c) Calculate the m/z ratio each for protein ions containing 5, 4, 3 and 2 charges. 
 OR
(c) A protein has a molecular weight of 20,000 daltons and it forms two protein ions containing 6 and 7 charges, What will be it‟s mass/charge ratio? 
EXPLANATION: (a) The molecular ions are generated either by a loss or gain of a charge (e.g. electron ejection, protonation or deprotonation)
(b) Mass spectrometry is used in-
(i) Obtaining protein structural information such as peptide mass or amino acid sequence
(ii) Identifying the type and location of amino acid modification within proteins. 
(c) (c)m/z= (M+ nH)^n+/ n+
For n=5, m/z= 10,000+ 5/5= 2001
For n=4,m/z= 10,000+ 4/4= 2501
For n=3, m/z= 10,000+ 3/3= 3334.3
For n=2, m/z= 10,000+ 2/2=5001
OR
(c) m/z= (M+ nH)^n+/ n+
For n=6, m/z= 20,000+ 6/6= 3334.33
For n=7, m/z= 20,000+7/7=2858.14

30 Growth kinetics is an autocatalytic reaction which implies that the rate of growth is 
directly proportional to the concentration of cell..
As the cell divides, we shall have


Doubling time which is the time taken by the population to double through one round of cell division is inversely related to specific growth rate.
(a) In a microbiology laboratory, one bacterial culture is marked “X” with generation time 20 s and other bacterial culture is marked “Y” with generation time 30 s. Which bacterial culture will proliferate rapidly?
(b) Using the above table, Calculate the number of divisions the population must have undergone to increase from 104to 107in 24 hours. 
(c) Using the above table ,Calculate the generation time (doubling time) of a bacterial population in which the number of bacteria increases from 10^8 cells/ml to 10^14 cells/ml during four hours of exponential growth.
OR
(c) Explain any two different ways to measure microbial growth. 
EXPLANATION:a) As generation time is inversely related to specific growth rate, hence bacterial 
culture marked “X” with generation time 20s will proliferate rapidly.
OR
 c) (i) Measurement of Dry mass and Wet mass
 (ii) Using a spectrophotometer
(iii) Using Slide counting Chamber
(iv) Using Coulter chamber

SECTION E
31 Several medically important protein pharmaceuticals have been produced using animal cell culture and recombinant DNA technology. Represent the animal cell line used for the production of the following proteins and their therapeutic use in a tabular form.
(a) Erythropoietin
(b) Factor VIII
(c) Follicle Stimulating Hormone (FSH)
(d) Interleukin 2 (IL 2)
(e) Monoclonal antibodies (mAbs)
OR
(a) Differentiate between-
(i) Defined and Serum-supplemented medium
(ii) Anchorage-dependent and Anchorage-independent cells
(b) Explain how pH is maintained in animal cell cultures. Mention two advantages of maintaining pH during such cultures.
EXPLANATION: 
OR
(a) (i) A defined medium has known chemicals, of fixed composition and can support growth of selected cells. Serum is an essential component of animal cell 
culture media and is a source of growth factors and hormones. 
(ii) Anchorage-dependent cells grow as adherent cells whereas anchorage-independent cells grow as suspension cultures.
(b) Most common buffering system used to maintain pH in animal cell Culture is Bicarbonate-CO2 system.Carbon dioxide from cells or atmosphere interacts with water and leads to drop in pH.

Increase in Bicarbonate concentration neutralizes the effect of increased Carbon dioxide according to the following equation:
The increased HCO3- ions derive the above equation to its left until equilibrium is 
reached at pH 7.4
Advantages :
i) pH is important to maintain in balance/ enzyme functions/ binding of 
hormones/growth factors to cell surface receptors/Ion balance

32(a) Dr. Sharma discovered first restriction enzyme ever from a bacteria called 
Thermus aquaticus, strain DR 15. Name the enzyme.
b) Design two primers (5 nucleotide long each) for the given sequence: 
5‟GATTCATTGCGCGCATTACTCGCATT3‟
c) Recognition sites are generally palindromic in nature. Does it point towards the structure of restriction enzymes being that of a homodimer or heterodimer? Give reason for your answer.
d) A bacteriophage is known to infect E.coli with pili. How can it be modified to serve as a suitable vector?
 OR
a) Schematically explain the formation of recombinant plasmid. 
b) Selection is an important step in genetic engineering. You are given ampicillin and tetracycline antibiotics. Using these antibiotics, which selection technique could be used to differentiate between recombinant and non-recombinant cells?
EXPLAINATION: (a) TaqDI
(b) 5' AATGC 3' and 5' GATTC 3' 
(c) Palindromic means the DNA sequence reads same when read from 5' to 3'. The Restriction enzyme is a homodimer. As it cuts both the strands of DNA simultaneously in 5' to 3' direction. 
(d) Foreign DNA can be inserted into bacteriophage single stranded, circular DNA of 6407 bp without disrupting any of the essential genes M13 is a filamentous phage which infects E. coli having a pilus (protrusion) which is selectively present in cells containing a F plasmid (called F+ cells). 
OR
b) Replica plating.
● Host cells are first plated (master plate) on solid media with the desired antibiotic overnight.
● Velvet paper is aligned, pressed on master plate.
● With the same alignment it is pressed onto the replica plate. 
● Keep it overnight ,transformed colonies will not grow in replica plate
● The colonies having insert can easily be scored off from the master plate by comparing the two plates.


33 (a) A group of students are trying to isolate recombinant insulin . After processing the fermentation broth, they observed no yield.What could be the most possible reason for this?
(b) A recently discovered microbial strain gives us the desired metabolite in nanomolar concentration. Suggest two ways of improving the production of the desired metabolite. 
(c) Pichia pastoris has many advantages as a eukaryotic expression host. Justify by giving two reasons. 
OR 
a) A professor told her students to ready a bacterial culture in 12 hours sharp. Suggest her students two ways to enhance the growth of bacterial cells in the lab so that they are able to fulfil the requirement. 
b) Write any two commercial significance of microbial cell culture. 
c) There are many ways of measuring microbial growth. Which technique is considered the best and why? 
EXPLANATION: (a) Recombinant insulin is an intracellular protein so we need to process the cell 
mass and not the fermentation broth.
(b) Strain improvement is done in order to maximize metabolite production by: 
i) Mutant selection : There are two methods - Physical method & Chemical Method 
ii) Genetic engineering 
(c) i) It has strong inducible promoters
ii) It is capable of making post-translational modifications similar to those performed by human cells
iii) Downstream processing is simpler as Pichia does not secrete its own proteins 
into the fermentation medium.
OR
a) Use of shake culture and Use of baffle flask
Baffle flask: One of the simplest ways is to produce a V- shaped notch or indentation in the sides of the flask. Such flasks are called baffle flasks . This improves the growth of the microbes by improving the efficiency of oxygen transfer due to increased turbulence of the agitated culture medium.
Shakers: Continuous agitation of the culture medium also greatly improves the efficiency of the oxygen transfer and this improves the growth of the microbes. In the laboratory, this is done by the use of shakers . Shakers may be end-to-end type or rotatory type. These may be designed for use at the ambient temperature or in a controlled temperature environment (incubator shaker).
b) 1. Production of whole microbial cells (for food, vaccines)
2. Production of primary metabolites (acids, alcohol)
3. Production of secondary metabolites (antibiotics)
4. Biotransformation reactions (enzymatic, steroid)
5. Exploitation of metabolism (microbial leaching, biodegradable waste treatment)
6. Synthesis of recombinant proteins (therapeutic proteins) Bioremediation/fermented food items/ recombinant proteins
c) Viable Plate Count is the best method since it does not count dead microbial cells

Comments

Popular posts from this blog

CELL STRUCTURE AND FUNCTION NCERT HIGHLIGHTS

THE FUNDAMENTAL UNIT OF LIFE

TISSUES